LOCUS ABAAQ0000000 mRNA linear HUM 17-APR-2009 DEFINITION Homo sapiens 5' cDNA fragments, random primer derived CRL-2429 CCD-1112Sk RIKEN Cap Analysis Gene Expression (CAGE) library. ACCESSION ABAAQ0000000 VERSION ABAAQ0000000.1 KEYWORDS MGA; 5'-end tag; CAGE (Cap Analysis Gene Expression). SOURCE Homo sapiens ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 AUTHORS Arakawa,T., Carninci,P., Fukuda,S., Hasegawa,A., Hayashida,K., Hori,F., Iida,J., Imamura,K., Kai,C., Katayama,S., Kawai,J., Kodzius,R., Kojima,M., Kondo,S., Murata,M., Nakamura,M., Nishiyori,H., Nomura,K., Ohno,M., Sasaki,D., Tagami,M., Tagami,Y., Waki,K. and Hayashizaki,Y. TITLE Direct Submission JOURNAL Submitted (18-APR-2005) to the DDBJ/EMBL/GenBank databases. Contact:Yoshihide Hayashizaki The Institute of Physical and Chemical Research (RIKEN), Omics Science Center, RIKEN Yokohama Institute; 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan URL :http://www.osc.riken.jp/ REFERENCE 2 AUTHORS Carninci,P., Sandelin,A., Lenhard,B., Katayama,S., Shimokawa,K., Ponjavic,J., Semple,C.A.M., Taylor,M.S., Engstrom,P., Frith,M.C., Forrest,A.R.R., Alkema,W.B., Tan,S.L., Plessy,C., Kodzius,R., Ravasi,T., Kasukawa,T., Fukuda,S., Kanamori-Katayama,M., Kitazume,Y., Kawaji,H., Kai,C., Nakamura,M., Konno,H., Nakano,K., Mottagui-Tabar,S., Arner,P., Chesi,A., Gustincich,S., Persichetti,F., Suzuki,H., Grimmond,S.M., Wells,C.A., Orlando,V., Wahlestedt,C., Liu,E.T., Harbers,M., Kawai,J., Bajic,V.B., Hume,D.A. and Hayashizaki,Y. TITLE Genome-wide analysis of mammalian promoter architecture and evolution JOURNAL Nat. Genet. 38, 626-635 (2006) REFERENCE 3 AUTHORS CONSRTM The FANTOM Consortium, RIKEN Genome Exploration Research Group and Genome Science Group (Genome Network Project Core Group) TITLE The Transcriptional Landscape of the Mammalian Genome JOURNAL Science 309, 1559-1563 (2005) REFERENCE 4 AUTHORS CONSRTM RIKEN Genome Exploration Research Group and Genome Science Group (Genome Network Project Core Group) and the FANTOM Consortium TITLE Antisense Transcription in the Mammalian Transcriptome JOURNAL Science 309, 1564-1566 (2005) REFERENCE 5 AUTHORS Shiraki,T., Kondo,S., Katayama,S., Waki,K., Kasukawa,T., Kawaji,H., Kodzius,R., Watahiki,A., Nakamura,M., Arakawa,T., Fukuda,S., Sasaki,D., Podhajska,A., Harbers,M., Kawai,J., Carninci,P. and Hayashizaki,Y. TITLE Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage JOURNAL Proc. Natl. Acad. Sci. U.S.A. 100, 15776-15781 (2003) REFERENCE 6 AUTHORS Kodzius,R., Matsumura,Y., Kasukawa,T., Shimokawa,K., Fukuda,S., Shiraki,T., Nakamura,M., Arakawa,T., Sasaki,D., Kawai,J., Harbers,M., Carninci,P. and Hayashizaki,Y. TITLE Absolute expression values for mouse transcripts: re-annotation of the READ expression database by the use of CAGE and EST sequence tags JOURNAL FEBS Lett. 559, 22-26 (2004) REFERENCE 7 AUTHORS Faulkner,G.J., Kimura,Y., Daub,C.O., Wani,S., Plessy,C., Irvine,K.M., Schroder,K., Cloonan,N., Steptoe,A.L., Lassmann,T., Waki,K., Hornig,N., Arakawa,T., Takahashi,H., Kawai,J., Forrest,A.R.R., Suzuki,H., Hayashizaki,Y., Hume,D.A., Orlando,V., Grimmond,S.M. and Carninci,P. TITLE The regulated retrotransposon transcriptome of mammalian cells JOURNAL Nat. Genet., 10.1038/ng.368 (2009) In press REMARK Publication_Status: Available-Online REFERENCE 8 AUTHORS Kawaji,H., Severin,J., Lizio,M., Waterhouse,A., Katayama,S., Irvine,K.M., Hume,D.A., Forrest,A.R.R., Suzuki,H., Carninci,C., Hayashizaki,Y. and Daub,C.O. TITLE The FANTOM Web Resource: from mammalian transcriptional landscape to its dynamic regulation JOURNAL Genome Biol. (2009) In press COMMENT CAGE library was prepared and sequenced in Genome Science Laboratory (Wako) and Genome Exploration Research Group Genomics Science Center (GSC) in RIKEN Yokohama Institute Please visit our web site for further details. URL:http://www.osc.riken.jp/ The CAGE (cap analysis gene expression) tags are obtained by sequencing concatamers of DNA tags deriving from the initial 20/21 nucleotides from 5' end mRNAs, prepared in accordance to Shiraki et al. (Proc Natl Acad Sci U S A. 100, 15776-81, 2003). At first step, full-length cDNAs were selected with the Cap-Trapper. Next, a specific linker (Linker1, which contains the ClassIIs restriction enzyme site MmeI) was ligated to the cDNA. Linker 1 may contain extra 5 bp sequences tag, and 15 of such different sequences tags were used to tag different starting RNA samples. Then the second strand of cDNA synthesized. Resulting double-stranded cDNAs were cleaved by the restriction enzyme MmeI and a second linker (Linker2) was ligated to the 2 bp overhang at the MmeI cleaved site, to produce a 5' 20/21 tag having two linkers at both sides. The ligation products were separated from unmodified DNA with magnetic beads. The 5' end cDNA tags were released from the beads, and the DNA fragments were amplified in a PCR step by using the two linker-specific primers (Primer1 (uni-PCR), Primer2 (MmeI-PCR)). The desired 32-37 bp tags were purified and ligated to form concatamers, and then the concatamer were fractionated and ligated to the plasmid ZErO-2. The ligations were finally electroporated into DH10b cells (Invitrogen) and obtained plasmids were sequenced with forward primers essentially as described with minor modifications to use zeocin for selection of recombinants. Each CAGE tag comprises short sequences of about 20bp derived from the 5' end of a full-length cDNA. The length of a CAGE tag may vary due to the limited specificity of MmeI. Note that up to 70% of the CAGE tags may have an unspecific G in the first position at the 5' end. We used in-house developed algorithms for the extraction of tags and for masking the vectors. CAGE tags were extracted with the following parameters: vector masking, minimum 12 bp recognition allowed; linker (13 bp) masking: maximum mismatch, 2 bp allowed; XmaJI site maximum mismatch, 2 bp allowed; tag length, 17-24 bp. Linker1: "Upper oligonucleotide GN6": biotin-agagagagacctcgagtaactataacggtcctaaggtagcgacctagg (5 bp) tccgacGNNNNN and "Upper oligonucleotide N6": biotin-agagagagacctcgagtaactataacggtcctaaggtagcgacctagg (5 bp) tccgacNNNNNN were mixed. "Lower oligonucleotide": phosphate group-gtcgga (5 bp) cctaggtcgctaccttaggaccgttatagttactcgaggtctctctc t-NH2 Linker2: "Upper-XmaJI": Pi-cctaggtcaggactcttctatagtgtcacctaaagacaca cacac -NH2 "Lower-XmaJI": gtgtgtgtgtctttaggtgacactatagaagagtcctgacc taggNN Primer1 (uni-PCR): 5'-biotin-GTGTGTGTGTCTTTAGGTGACACTA-3' Primer2 (MmeI-PCR): 5'-biotin-AGAGAGAGACCTCGAGTAACTATAA-3' Tissues were provided by Dr. Lars Bjorklund, Dr.Ahrlund-Richter(Karolinska Ins.),whose assistance we gratefully acknowledge FEATURES Location/Qualifiers source /cell_line="CRL-2429 CCD-1112Sk" /clone_lib="human Cap Analysis Gene Expression (CAGE) library" /db_xref="taxon:9606" /mol_type="mRNA" /note="primer random derived" /note="comment: passage's number=16" /note="eVOC_id: EV:0100375" /organism="Homo sapiens" /sex="male" /strain="caucasian" MGA ABAAQ0000001-ABAAQ0268395 total number of count : 992426 Header Format >[ACC#]|[submitter's identifier]|[number of sequence count]|[map]|[free text]|[db_xref1(,db_xref2,...)]| //