DDBJ 16S ribosomal RNA sequence data of prokaryotes June 2026, including 1,884,292 sequences Last published date in the present data: May 2026 ------------------------------------------------------------------------------- Table of contents ------------------------------------------------------------------------------- 1. Introduction 2. Format of sequence data 2.1. Description line 2.2. Sequence block 3. Contact information 4. Acknowledgment 5. Disclaimer 6. Statistics ------------------------------------------------------------------------------- 1. Introduction The 16S ribosomal RNA sequence data is extracted from DDBJ periodical release 142.0 by the following steps. 1) Select rRNA features from DDBJ periodical release matching with following conditions. 1-a) Belonging to BCT division; i.e. derived from bacteria or archea. 1-b) Including "16S", "16s", "RRS", "rrs", "SSU" or "ssu" in its /product qualifer value. 1-c) The sequance span of the feature location is longer than 300 bp. 2) Exclude rRNA sequences from the data set of step 1), when the results of blast to NCBI 16S rRNA reference sequences are matching with all of following conditions. - Complementary sequence matching - Identities is more than 80% - Coverage of aligned sequence is more than 50% 2. Format of sequence data This data is provided in a FASTA format that begins with a single-line description, followed by lines of nucleotide sequence data. A example of 16S rRNA sequence. ------------------------------------------------------------------------------- >AB000001_1|Sphingomonas sp.|16S ribosomal RNA agctgctaatattagagccctatatatagagggggccctatactagagatatatctatca gctaatattagagccctatatatagagggggccctatactagagatatatctatcaggct attagagccctatatatagagggggccctatactagagatataagtcgacgatattagca agccctatatatagagggggccctatactagagatatatctatcaggtgcacgatcgatc cagctagctagc ------------------------------------------------------------------------------- 2.1. Description line The description line starts with [>], followed by the below items. ------------------------------------------------------------------------------- >[ACCESSION]_[SERIAL]|[ORGANISM]|[PRODUCT] ------------------------------------------------------------------------------- - [ACCESSION]: The accession number of the entry including the rRNA feature. - [SERIAL] : The serial number of the rRNA feature assigned in the order of rRNA feature appeared in the entry with the accession number. - [ORGANISM] : Organism name; the value of /organism qualifier of the entry with the accession number. - [PRODUCT] : Product name; the value of /product qualifier of the rRNA feature 2.2. Sequence block The nucleotide sequence of the rRNA feature is extracted from the entry according to its location. 3. Contact information DNA Data Bank of Japan Bioinformation and DDBJ Center National Institute of Genetics Research Organization of Information and Systems Mishima 411-8540, Japan Phone: +81 55 981 6853 FAX: +81 55 981 6849 E-mail: ddbj@ddbj.nig.ac.jp WWW: https://www.ddbj.nig.ac.jp/ 4. Acknowledgment We are grateful to NCBI for providing 16S rRNA reference sequences to us. 5. Disclaimer While DDBJ endeavors to keep its data correct, DDBJ makes no representations or warranties of any kind about the completeness, accuracy or reliability with respect to the sequences contained in the 16S rRNA sequence data. DDBJ also makes no legal liability or responsibility of merchantability or fitness for a particular purpose or that the use of the sequence data will not infringe any patent or other rights. Any receipt, reliance or use you place on such data is therefore strictly at your own risk. 6. Statistics The followings are statistics of the current 16S rRNA sequence data. =============================================================================== file name no. of sequences file size =============================================================================== 16S.fasta.gz 1884292 217957840 =============================================================================== -1,100 bp : average length of 16S rRNA sequences 2,706,257 : 1-a) number of total rRNA features in BCT division of rel. 142.0 1,918,136 : 1-b) number of 16S rRNA candidates, i.e. including either of terms in /product qualifier 1,889,165 : 1-c) number of 16S rRNA candidates, longer than 300 bp in their length