| description |
Using ancient DNA, we investigate the history of cattle domestication in the Near East.NOTE: some fastq files have been generated from the same PCR. These are noted as such in the Library Name metadata for each fastq. Please using the library metadata for RGLB when assigning read groups, and for each sample remove duplicates following merging of aligned fastq files.NOTE: for some samples, only trimmed fastq files ("sample_trimmed.fastq.gz") have been uploaded. These were generated with the following cutadapt (https://cutadapt.readthedocs.io/en/stable/guide.html) command: cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -O 1 -m 30NOTE: all data has been treated with Uracil DNA endonuclease EXCEPT where noted in the Library metadata. Specifically, this refers to Bub1 and certain fastq files for Th7. |