| attributes |
| ENA first public |
2014-09-27 |
| ENA last update |
2016-10-21 |
| ENA-CHECKLIST |
ERC000024 |
| External Id |
SAMEA2673225 |
| INSDC center alias |
VTT |
| INSDC center name |
VTT Technical Research Centre of Finland |
| INSDC first public |
2014-09-27T17:04:05Z |
| INSDC last update |
2016-10-21T09:43:58Z |
| INSDC status |
public |
| Submitter Id |
OL-KR23A |
| adapters |
CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG |
| alkalinity |
0.28 |
| calcium |
2100 |
| chloride |
7930 |
| collection date |
2009-12-15 |
| conductivity |
2190 |
| environment (biome) |
aquifer |
| environment (feature) |
saline groundwater |
| environment (material) |
water |
| geographic location (country and/or sea) |
Finland |
| geographic location (depth) |
347 |
| geographic location (latitude) |
61.23694444 |
| geographic location (longitude) |
21.44083333 |
| geographic location (region and locality) |
Olkiluoto |
| investigation type |
metagenome |
| magnesium |
0.002 |
| multiplex identifiers |
ACTCAG |
| nucleic acid extraction |
MoBio Power water RNA extraction kit |
| organism count |
250000 / ml |
| oxygenation status of sample |
anaerobic |
| pcr primers |
ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC |
| ph |
7.5 |
| project name |
DeepOlki |
| sample collection device or method |
pumping |
| sample material processing |
concentration by filtration |
| sample name |
OL-KR23A |
| sample volume or weight for DNA extraction |
1000 |
| sequencing method |
454 Titanium |
| source material identifiers |
groundwater |
| water environmental package |
water |
|