| attributes |
| ENA first public |
2014-09-27 |
| ENA last update |
2016-10-21 |
| ENA-CHECKLIST |
ERC000022 |
| External Id |
SAMEA2674924 |
| INSDC center alias |
VTT |
| INSDC center name |
VTT Technical Research Centre of Finland |
| INSDC first public |
2014-09-27T17:04:03Z |
| INSDC last update |
2016-10-21T09:33:21Z |
| INSDC status |
public |
| Submitter Id |
Peat-50-100cm-B |
| annotation source |
GreeneGenes |
| collection date |
2013-06-15 |
| current land use |
Natura 2000 and National Mire Conservation Programme |
| current vegetation |
cotton grass (Eriophorum vaginatum), heather, cloudberry, cranberry, Sphagnum fuscum, bog rosemary, bog bilberry, crowberry, Cladina stellari, Cladonia sp., Cetraria islandica and Dicranum sp. |
| depth |
0.5 |
| environment (biome) |
raised bog |
| environment (feature) |
bog core |
| environment (material) |
peat |
| geographic location (country and/or sea) |
Finland |
| geographic location (elevation) |
44 |
| geographic location (latitude) |
61.291912 |
| geographic location (longitude) |
21.839473 |
| geographic location (region and locality) |
Lastensuo |
| investigation type |
metagenome |
| pcr primers |
AGAGTTTGATCCTGGCTCAG, ATTACCGCGGCTGCTGG |
| ph |
3.1 |
| project name |
Raised bog bacteria |
| sample collection device or method |
15 cm diameter peat auger |
| sample material processing |
freezing in sterile 50 ml plastic test tubes |
| sample name |
Peat-50-100cm-B |
| sample volume or weight for DNA extraction |
0.55 |
| sequencing method |
454 |
| soil environmental package |
soil |
| total organic C method |
loss on ignition |
| total organic carbon |
995 |
| water content |
0.89 |
|