attributes |
ENA first public |
2014-09-27 |
ENA last update |
2016-10-21 |
ENA-CHECKLIST |
ERC000022 |
External Id |
SAMEA2674929 |
INSDC center alias |
VTT |
INSDC center name |
VTT Technical Research Centre of Finland |
INSDC first public |
2014-09-27T17:04:02Z |
INSDC last update |
2016-10-21T09:33:21Z |
INSDC status |
public |
Submitter Id |
Peat-350-370cm-B |
annotation source |
GreeneGenes |
collection date |
2013-06-15 |
current land use |
Natura 2000 and National Mire Conservation Programme |
current vegetation |
cotton grass (Eriophorum vaginatum), heather, cloudberry, cranberry, Sphagnum fuscum, bog rosemary, bog bilberry, crowberry, Cladina stellari, Cladonia sp., Cetraria islandica and Dicranum sp. |
depth |
3.5 |
environment (biome) |
raised bog |
environment (feature) |
bog core |
environment (material) |
peat |
geographic location (country and/or sea) |
Finland |
geographic location (elevation) |
44 |
geographic location (latitude) |
61.291912 |
geographic location (longitude) |
21.839473 |
geographic location (region and locality) |
Lastensuo |
investigation type |
metagenome |
pcr primers |
AGAGTTTGATCCTGGCTCAG, ATTACCGCGGCTGCTGG |
ph |
3.2 |
project name |
Raised bog bacteria |
sample collection device or method |
15 cm diameter peat auger |
sample material processing |
freezing in sterile 50 ml plastic test tubes |
sample name |
Peat-350-370cm-B |
sample volume or weight for DNA extraction |
0.51 |
sequencing method |
454 |
soil environmental package |
soil |
total organic C method |
loss on ignition |
total organic carbon |
998 |
water content |
0.94 |
|