| Amount of sample collected |
500 ml |
| ENA first public |
2011-06-14 |
| ENA last update |
2018-03-09 |
| External Id |
SAMEA841730 |
| Geographic location (country:region,area) |
South Korea: Gwangju, Yeongsan River basin |
| INSDC center alias |
GIST |
| INSDC center name |
Gwangju Institute of Science and Technology, South Korea |
| INSDC first public |
2011-06-14T12:21:03Z |
| INSDC last update |
2018-03-09T09:53:23Z |
| INSDC status |
public |
| Submitter Id |
mixed-feces-in-freshwater |
| collection date |
2009-09-01 |
| environment (feature) |
animal-associated habitat |
| environment (material) |
feces |
| multiplex identifier |
GACACTGTAC |
| nucleic acid extraction |
stool DNA extraction kit (Bioneer, South Korea) |
| pcr primers |
FW:AACGCTAGCTACAGGCTTAACA RW:CAATATTCCTCACTGCTGCCTCCCGTA |
| project name |
Bacteroidetes Microbial Source Tracking (MST) |
| sample material processing |
freeze dried |
| sample name |
mixed-feces-in-freshwater |
| sequencing method |
Pyrosequencing |
| target gene |
16S rRNA |