Amount of sample collected |
30 individual feces pooled into one and 250mg was used |
ENA first public |
2011-06-14 |
ENA last update |
2018-03-09 |
External Id |
SAMEA841735 |
Geographic location (country:region,area) |
South Korea: Gwangju, Yeongsan River basin |
INSDC center alias |
GIST |
INSDC center name |
Gwangju Institute of Science and Technology, South Korea |
INSDC first public |
2011-06-14T12:21:02Z |
INSDC last update |
2018-03-09T09:53:23Z |
INSDC status |
public |
Submitter Id |
Human-feces |
collection date |
2009-09-01 |
environment (feature) |
animal-associated habitat |
environment (material) |
feces |
multiplex identifier |
ACAGTCACAC |
nucleic acid extraction |
stool DNA extraction kit (Bioneer, South Korea) |
pcr primers |
FW:AACGCTAGCTACAGGCTTAACA RW:CAATATTCCTCACTGCTGCCTCCCGTA |
project name |
Bacteroidetes Microbial Source Tracking (MST) |
sample material processing |
swab |
sample name |
Human-feces |
sequencing method |
Pyrosequencing |
target gene |
16S rRNA |