home > sra-sample > ERS1258486
identifier ERS1258486
type sra-sample
sameAs
biosample　 SAMEA4347037
organism soil metagenome
attributes
ENA first public　 2016-09-29
ENA last update　 2016-10-21
External Id　 SAMEA4347037
INSDC center alias　 LECA
INSDC center name　 Laboratoire d'Ecologie Alpine
INSDC first public　 2016-09-29T17:01:46Z
INSDC last update　 2016-10-21T09:34:43Z
INSDC status　 public
Submitter Id　 JMB_F_20c
collection date　 2010-08
common name　 Fungal MOTU
composite design/sieving (if any)　 sieving 2 mm
depth　 0.05-0.1
environment (biome)　 meadow
environment (feature)　 unmown terrace
environment (material)　 grassland soil
geographic location (country and/or sea)　 France
geographic location (elevation)　 1700
geographic location (latitude)　 45.07
geographic location (longitude)　 6.57
geographic location (region and locality)　 French Alps Lautaret
investigation type　 metagenome
links to additional analysis　 doi: 10.1111/1365-2645.12014
multiplex identifiers　 gatgatct:actagatc
pcr primers　 CAAGAGATCCGTTGTTGAAAGTT:GGAAGTAAAAGTCGTAACAAGG
project name　 Vital_WP4-Fun
sample name　 JMB_F_20c
sequencing method　 Miseq pair-end 250 nt
soil environmental package　 soil
target gene　 ITS1
properties　▽ 
{...}
dbXrefs
bioproject　 PRJEB14389
sra-run　 ERR1544534ERR1544535
sra-submission　 ERA676220
biosample　 SAMEA4347037
sra-study　 ERP016030
sra-experiment　 ERX1615299ERX1615300
distribution JSONJSON-LD
Download
ERA676220.sample.xml　 HTTPS FTP
status public
visibility unrestricted-access
dateCreated 2016-09-30T14:48:17Z
dateModified 2021-09-24T10:30:41Z
datePublished 2016-10-01T14:42:59Z