attributes |
ENA first public |
2014-09-27 |
ENA last update |
2016-10-21 |
External Id |
SAMEA2673218 |
INSDC center alias |
VTT |
INSDC center name |
VTT Technical Research Centre of Finland |
INSDC first public |
2014-09-27T17:04:03Z |
INSDC last update |
2016-10-21T09:43:57Z |
INSDC status |
public |
Submitter Id |
OL-KR13A |
adapters |
CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG |
alkalinity |
2.19 |
calcium |
460 |
chloride |
2920 |
collection date |
2010-03-09 |
conductivity |
897 |
environment (biome) |
aquifer |
environment (feature) |
saline groundwater |
environment (material) |
water |
geographic location (country and/or sea) |
Finland |
geographic location (depth) |
296 |
geographic location (latitude) |
61.23694444 |
geographic location (longitude) |
21.44083333 |
geographic location (region and locality) |
Olkiluoto |
investigation type |
metagenome |
magnesium |
0.0014 |
multiplex identifiers |
TACATA |
nucleic acid extraction |
MoBio Power water RNA extraction kit |
organism count |
420000 / mL |
oxygenation status of sample |
anaerobic |
pcr primers |
ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC |
ph |
7.9 |
project name |
DeepOlki |
sample collection device or method |
pumping |
sample material processing |
concentration by filtration |
sample name |
OL-KR13A |
sample volume or weight for DNA extraction |
1000 |
sequencing method |
454 Titanium |
source material identifiers |
groundwater |
water environmental package |
water |
|